Accueil > Pour en savoir plus > Biologie Génétique Epigénétique > "Mauvaise nouvelle : un processus mutationnel (la chromothripsie) induit un (...)

"Mauvaise nouvelle : un processus mutationnel (la chromothripsie) induit un effet involontaire ’catastrophique’ lors de l’utilisation de la technologie l’édition de gènes (ou édition génomique) avec CRISPR" par Claire Robinson

Traduction et compléments de Jacques Hallard

dimanche 31 octobre 2021, par Robinson Claire


ISIAS Génétique CRISPR Cancer

Mauvaise nouvelle : un processus mutationnel (la chromothripsie) induit un effet involontaire ’catastrophique’ lors de l’utilisation de la technologie l’édition de gènes (ou édition génomique) avec CRISPR

Traduction du 29 octobre 2021 par Jacques Hallard – avec ajout de compléments sur la chromothripsie , l’édition de gènes, la technologie CRISPR et un autre article d’Inf’OGM sur ce sujet – d’un rapport de Claire Robinson en date du 22 septembre 2021 publié par ‘gmwatch.org’ sous le titre « Chromothripsis : Bad news for gene editing  » ; accessible sur ce site : https://www.gmwatch.org/en/news/latest-news/19885-chromothripsis-bad-news-for-gene-editing


[Définitions préalables ajoutées]

La chromothripsie est un processus mutationnel par lequel jusqu’à des milliers de réarrangements chromosomiques groupés se produisent en un seul événement dans des régions génomiques localisées et confinées dans un ou quelques chromosomes, et est connu pour être impliqué à la fois dans le cancer et les maladies congénitales. Il se produit par un réarrangement génomique massif au cours d’un seul événement catastrophique dans l’histoire de la cellule. On pense que pour que la cellule soit capable de résister à un événement aussi destructeur, l’occurrence d’un tel événement doit être la limite supérieure de ce qu’une cellule peut tolérer et survivre. [1]

Le phénomène de chromothripsie s’oppose à la théorie conventionnelle selon laquelle le cancer est l’acquisition progressive de réarrangements génomiques et de mutations somatiques au fil du temps. [2]

Le modèle le plus simple quant à la façon dont ces réarrangements se produisent est la fragmentation simultanée de régions chromosomiques distinctes (les points de rupture montrent une distribution non aléatoire), puis un réassemblage imparfait ultérieur par des voies de réparation de l’ADN ou des mécanismes de réplication aberrantes de l’ADN. La chromothripsie survient tôt dans le développement de la tumeur et conduit à une transformation cellulaire par perte de suppresseurs de tumeur et d’amplifications d’oncogènes. [3]

En 2015, il a été découvert que la chromothripsie peut également être curative : une femme qui souffrait du syndrome WHIM (verrues, hypogamma-globulinémie, infections et myélokathexis), une maladie d’immunodéficience combinée autosomique dominante extrêmement rare, a constaté que ses symptômes avaient disparu au cours de sa trentaine après la chromothripsie du chromosome. 2 ont supprimé l’allèle de la maladie. [4]

Chromothripsise est un néologisme qui vient des mots grecs chromo qui signifie couleur (et représente les chromosomes car ils sont fortement colorés par des colorants particuliers) et thripsis qui signifie « se briser en morceaux ». [2]

Chromothripsie - le résultat d’un seul événement catastrophique dans l’histoire d’une cellule. Traduit par JH de Chromothripsis - From Wikipedia, the free encyclopedia

Source de l’article complet : https://en.wikipedia.org/wiki/Chromothripsis

Pour lire d’autres traductions automatiques d’articles scientifiques et médicaux sur la chromothripsie, se reporter plus loin

Retour au début du dossier


L’édition de gènes ou édition génomique

Édition génomique selon Wikipédia

https://upload.wikimedia.org/wikipedia/commons/thumb/a/a7/Nuclease-intro-text-to-path.svg/295px-Nuclease-intro-text-to-path.svg.png

Schéma général du processus de modification localisée du génome.

L’édition génomique ou modification localisée de séquence génomique (genome editing pour les anglophones) regroupe un ensemble de techniques de manipulation du génome visant à la modification du matériel (et donc de l’information) génétique. Ces techniques sont plus précises et ciblées que les techniques OGM historiques qui voient ces organismes transformés par transgenèse qui introduit des modifications génétiques au niveau d’un site « au hasard » dans le génome.

Les termes « édition génomique » ou « édition du génome », bien que couramment employés, sont à éviter car contrairement au mot anglais « editing », le mot « édition » ne signifie pas « modifier, corriger, retoucher ». L’expression « édition génétique » est aussi à éviter car ayant un autre sens1.

Ces techniques peuvent être appliquées aux plantes, aux animaux2, aux champignons et aux organismes unicellulaires, procaryotes ou eucaryotes. Certains laboratoires proposent aussi de les appliquer au génome humain… -

Lire l’article complet sur ce site : https://fr.wikipedia.org/wiki/%C3%89dition_g%C3%A9nomique

Retour au début du dossier


CRISPR : comment ça marche ? - 9 avril 2021, 19:16 CEST – Auteur : Alexis VergerChargé de Recherche au CNRS, ERL 9002, Université de Lille - Déclaration d’intérêts : Alexis Verger a reçu des financements du CNRS et de l’ANR. Partenaires :

Université de Lille

Université Lille Nord-Europe (ULNE)

Université de Lille et Université Lille Nord-Europe (ULNE) fournissent des financements en tant que membres adhérents de ‘The Conversation FR’. Voir les partenaires de The Conversation France.

CRISPR-Cas9, c’est la possibilité de couper des séquences d’ADN où on le veut. Cela peut être très utile par exemple lorsqu’une maladie génétique est causée par une mutation délétère, c’est-à-dire quand une petite partie d’une double hélice d’ADN est mal encodée, et que l’on connaît bien quelle est cette mutation et où elle se trouve. On peut alors, grâce à CRISPR-Cas9, couper le morceau d’ADN impliqué. L’idée est ensuite de remplacer cette séquence mutée par une séquence d’ADN qui corrige la mutation. Ces maladies génétiques causées par une seule mutation sont en fait assez rares, car la plupart d’entre elles sont « multifactorielles » – plusieurs gènes et mutations sont impliqués – mais cela marche plutôt bien. L’utilisation de l’édition des génomes est très encadrée, et la France est signataire de la convention d’Oviedo qui interdit de faire des modifications transmissibles à la descendance.

Pour couper où on veut, il faut d’abord se repérer dans le génome, c’est-à-dire trouver la séquence d’ADN que l’on veut couper. C’est le travail de la première composante de CRISPR-Cas9, que l’on appelle l’ARN-guide (constitué d’une séquence variable complémentaire de la séquence d’ADN à cibler et d’un petit ARN propre à l’enzyme Cas9). Une fois guidée au bon endroit, l’enzyme Cas9 coupe le double brin d’ADN.

https://images.theconversation.com/...

https://images.theconversation.com/files/393981/original/file-20210408-17-wpq680.jpg?ixlib=rb-1.1.0&q=45&auto=format&w=754&fit=clip

Le système CRISPR-Cas9 : la nucléase Cas9 (en gris) est guidée par une séquence ARN guide (en rouge) comprenant une séquence homologue à la séquence ADN-cible (en orange). Le complexe Cas9/ARN guide scanne ensuite le génome pour trouver un site PAM (en noir) ce qui conduit à l’ouverture du double brin d’ADN et à la formation d’un hétéroduplex ARN-ADN avec la séquence d’ADN complémentaire. Modifié par Elsa Couderc à partir de Thomas Splettstoesser, Wikipedia, CC BY-SA

On peut faire une analogie avec un traitement de texte : on repère un mot avec une faute d’orthographe au sein d’un énorme ouvrage (l’ARN-guide correspond à la fonction « rechercher »), on coupe le mot erroné (l’enzyme nucléase Cas9 correspond à la fonction « couper »). Ensuite, mais on sort du système CRISPR-Cas9 à proprement parler, on peut ajouter le mot corrigé (la fonction « coller », que nous verrons plus loin).

La force de CRISPR-Cas9 par rapport aux systèmes de découpe du génome que l’on connaissait auparavant, c’est que cette technique est programmable : on peut concevoir et synthétiser la séquence d’ARN-guide correspondant précisément à la séquence d’ADN que l’on souhaite découper. D’autres techniques de découpage du génome existaient avant CRISPR-Cas9, par exemple les « nucléases à doigts de zinc » ou les TALEN, mais elles étaient bien plus complexes et longues à mettre en œuvre.

Le système CRISPR-Cas9 est un système naturel chez les bactéries qui l’utilisent comme mécanisme de défense contre les ADN étrangers. Il a été découvert dans les années 2000 puis « détourné » en 2012 par Jennifer Doudna et Emmanuelle Charpentier pour en faire un outil de biotechnologie et aujourd’hui de thérapie génique.

Comment l’ARN-guide trouve-t-il la séquence qui lui correspond dans tout cet ADN ?

Le complexe formé par l’enzyme Cas9 et son ARN-guide scanne tout au long des chromosomes et s’arrête quand elle trouve la séquence qui correspond à l’ARN-guide. Une des choses fascinantes dans cette technique CRISPR-Cas9 – en dehors de sa facilité de mise en œuvre –, c’est qu’elle est issue d’un système naturel bactérien, mais qu’elle fonctionne bien aussi chez les eucaryotes. En effet, chez ses derniers, la présence d’histones, les principaux constituants protéiques des chromosomes qui n’ont pas d’équivalents chez les bactéries, et d’un noyau ne semblent pas outre mesure empêcher l’enzyme Cas9 d’accéder au génome des eucaryotes et de couper l’ADN.

L’ARN-guide emmène son enzyme Cas9 vers une petite séquence spécifique de 20 nucléotides, alors que le génome humain fait environ 3 milliards de paires de bases au total. L’ARN-guide est complémentaire de la séquence d’ADN que l’on cherche à couper. Par exemple, une séquence ADN-cible ACGGACCTTACCTGAAAAAT est complémentaire d’une séquence TGCCTGGAATGGACTTTTTA (A correspond à T et C à G). La probabilité pour retrouver plusieurs fois la même séquence précise de 20 paires de bases parmi tout le génome est très très faible – même s’il y a encore beaucoup de questionnements à l’heure actuelle sur le risque de couper à un autre endroit que la séquence voulue.

Une fois la cible détectée, l’ARN-guide et l’ADN-cible forment un « duplex » ARN-ADN. L’ARN et l’ADN sont très proches physiquement, et la protéine Cas9 est à portée de ciseaux. Mais elle ne pourra couper le double brin d’ADN-cible que si celui-ci contient également une séquence dite PAM (pour Protospacer Adjacent Motif), constituée de trois nucléotides. Dans le cas de Cas9, le « PAM » est constitué des nucléotides NGG (n’importe quel nucléotide, puis deux G à la suite). Si l’ADN cible ne présente pas cette séquence, l’enzyme Cas9 ne peut pas couper, ce qui restreint bien sûr les applications.

Comment ça coupe ?

Cas9 est une nucléase, c’est-à-dire une enzyme qui clive les liaisons moléculaires reliant les nucléotides de l’ADN. Elle contient deux domaines (RuvC et HNH) qui lui permettent de couper les deux brins d’ADN. Il existe des dizaines d’autres enzymes nucléases en dehors de l’enzyme Cas9.

Après la coupure

Une fois que le système CRISPR-Cas9 a coupé la double hélice d’ADN, la cellule va tout mettre en place pour réparer cette lésion, en raboutant les deux morceaux qui viennent d’être coupés par des mécanismes de réparation cellulaire. La cellule peut soit réparer par la jonction d’extrémités non homologues (NHEJ), ce qui induit des délétions et donc l’inactivation du gène, soit par recombinaison homologue (en présence d’un brin ADN donneur), ce qui permet la réparation.

C’est à l’heure actuelle un sujet important de recherche, car il est toujours difficile d’avoir des réparations efficaces ou qui correspondent à ce que l’on souhaiterait. Par exemple, quand on essaye de corriger une mutation dans des lignées cellulaires au laboratoire, il y a souvent moins d’un pour cent des cellules testées qui ont exactement la bonne coupure et la bonne réparation. Ceci dit, ces problèmes se poseraient quel que soit le mécanisme de découpage utilisé (CRISPR-Cas9, nucléases à doigt de zinc, etc.) puisqu’ils dépendent en fait de la cellule et des mécanismes de réparation cellulaire.

Les « autres » CRISPR – ou comment la technique évolue

Pour les thérapies géniques, il faut d’abord pouvoir accéder à l’ADN incriminé. Il est par exemple plus facile d’accéder au sang et donc à une mutation localisée dans le sang qu’à des organes internes comme le foie. Pour arriver jusqu’à l’ADN, il faut un « véhicule », mais certains de ces transporteurs ne sont pas assez gros pour contenir l’enzyme Cas9, qui est très grande. C’est pour cela que des chercheurs cherchent d’autres enzymes Cas, plus courtes, qui pourront être plus facilement transportées par ces véhicules.

D’autres enzymes Cas sont aussi à l’étude pour leur spécificité de séquence, en particulier pour identifier d’autres séquences PAM, qui permettent la découpe, que la séquence très spécifique NGG associée à l’enzyme Cas9. Ces autres enzymes Cas seront utiles pour cibler les mutations génétiques entourées d’une autre séquence que NGG.

Enfin, des enzymes Cas dites « haute-fidélité » permettent de gagner en efficacité, et d’éviter de couper à des endroits non souhaités.

Mots clefs : génétique ADN biologie génome CRISPR manipulation du vivant biologie moléculaire édition du génome

The Conversation : des analyses de l’actualité

L&#39 ;Angleterre pourrait-elle être poursuivie pour avoir mis le monde en danger de Covid-19 ? - ThePressFree

Source : https://theconversation.com/recit-anime-la-grande-saga-crispr-une-histoire-de-manipulations-genetiques-157691

Retour au début du dossier

Article traduit :

La découverte d’un effet involontaire ’catastrophique’ de l’édition de gènes CRISPR pourrait avoir provoqué l’effondrement des actions des entreprises.

La modification génétique avec CRISPR est souvent présentée comme une procédure simple, précise et sûre. Mais les résultats de recherches récentes sur l’édition de gènes avec CRISPR pour des applications de thérapie génique, montrent qu’elle peut entraîner des dommages massifs aux chromosomes. Ce phénomène est connu sous le nom de chromothripsie.

Un article paru dans ‘Nature Biotechnology’ sur ces nouvelles découvertes décrit la chromothripsie comme ’une forme extrêmement dommageable de réarrangement génomique qui résulte de l’éclatement de chromosomes individuels et de la réunion ultérieure des morceaux dans un ordre désordonné’.

Aujourd’hui, certains signes indiquent que les résultats de cette étude ont un impact sur les actions des sociétés d’édition de gènes ou édition génomique.

’Vous ne pouvez pas faire disparaître cela’

Les auteurs de la nouvelle étude, publiée dans ‘Nature Genetics’, concluent que ’la chromothripsie est une conséquence sur cible jusqu’alors non appréciée’ des cassures double brin de l’ADN que l’édition de gènes CRISPR est censée provoquer. Le fait que les dommages se produisent ’sur la cible’ - au site d’édition prévu - signifie que toute tentative de cibler plus précisément l’édition du gène CRISPR ne résoudra pas ce problème, comme le souligne dans l’article de ‘Nature Biotechnology’ l’un des chercheurs de l’étude, David Pellman du ‘Dana-Farber Cancer Institute’ et de la ‘Harvard Medical School’. Il a déclaré : ’Vous ne pouvez pas faire disparaître le problème en rendant la coupure plus spécifique.’

Inquiétudes concernant le cancer

La principale inquiétude liée à la chromothripsie dans un cadre thérapeutique est qu’elle peut entraîner un cancer ou une maladie héréditaire chez les enfants du patient concerné. Il suffirait qu’une seule cellule soit affectée par la chromothripsie pour qu’un cancer apparaisse.

Cela a des implications pour l’édition de gènes chez les animaux, car les animaux édités pourraient être sujets au cancer. Mais c’est aussi une mauvaise nouvelle pour l’édition de gènes de plantes, où les dommages chromosomiques entraîneraient des changements dans la fonction des gènes qui pourraient à leur tour entraîner une toxicité ou une allergénicité inattendue, ainsi que des effets imprévisibles sur la faune.

Les effets ’ne peuvent être complètement évités’.

Alors qu’un expert interrogé pour l’article de ‘Nature Biotechnology’ est optimiste quant à la capacité du domaine de l’édition de gènes à ’innover pour contourner’ ce problème et tout autre problème découlant des processus CRISPR, les chercheurs de l’article original semblent moins convaincus.

C’est ce qui ressort de la version préliminaire de leur article, qui est apparue sur ‘BioRxiv’ avant que la version évaluée par les pairs ne soit publiée dans ‘Nature Biotechnology’. Dans la version préliminaire, les auteurs qualifient sans ambages la chromothripsie de ’processus de mutation catastrophique’ et préviennent qu’il s’agit d’une ’toxicité ciblée qui peut être minimisée par des protocoles de manipulation cellulaire ou par le criblage, mais qui ne peut être complètement évitée dans de nombreuses applications d’édition du génome’.

Toutefois, cette formulation est absente de la version finale publiée. La conclusion initiale pessimiste sur l’impossibilité d’éviter la chromothripsie a été diluée dans une déclaration insipide : ’Au fur et à mesure que l’édition du génome est mise en œuvre dans la clinique, le potentiel de réarrangements chromosomiques étendus doit être considéré et surveillé.’

Des investisseurs qui ont peur

Parmi ceux qui ne sont pas convaincus que ce problème inhérent à CRISPR peut être résolu, on trouve les investisseurs dans les entreprises basées sur la technologie CRISPR. Un article du site d’information sur les investissements ‘Seeking Alpha’ indique que les ’nouvelles données concernant la chromothripsie peuvent affecter les perspectives à long terme de sociétés telles que Crispr Therapeutics’. Les actions de ces sociétés (rassemblées dans un fonds connu sous le nom d’ARKG), qui étaient auparavant en forte hausse, ont soudainement chuté en juillet de cette année, le même mois que la publication de l’étude de ‘Nature Biotechnology’.

L’article de ‘Seeking Alpha’ poursuit : ’L’impact à long terme de l’édition de gènes sur la santé pourrait ne pas être connu avant 2040 environ’ Il conclut : ’Compte tenu des perspectives incertaines, les investisseurs seraient bien avisés de réévaluer leurs positions dans les entreprises qui emploient la cassure du double brin d’ADN pour modifier le génome.’

‘Seeking Alpha’ ne va pas jusqu’à accuser les résultats de la chromothripsie d’être la seule ou la principale cause de la chute d’ARKG, mais note qu’il s’agit d’’un facteur contributif’.

La chromothripsie n’est que le dernier d’une longue liste de résultats involontaires induits par la technologie CRISPR, qui peuvent se produire sur le site d’édition prévu et qui ne peuvent donc pas être évités en améliorant le ciblage de CRISPR. Malgré cela, les décideurs politiques au Royaume-Uni et dans l’UE continuent de faire écho aux récits des lobbyistes de l’industrie selon lesquels l’édition de gènes CRISPR est précise et que les résultats prévisibles.

Image : Kumamon Y. Watson via Wiki Commons. Reproduite sous la licence Creative Commons Attribution-Share Alike 3.0 Unported.

GMWatch Home

GMWatch Home

Content 1999 - 2021 GMWatch. Web Development By SCS Web Design – Source : https://www.gmwatch.org/en/news/latest-news/19885-chromothripsis-bad-news-for-gene-editing


Compléments sur la Chromothripsie (suite)

Elsevier

Morphologie Volume 100, Issue 330, September 2016, Page 161

Morphologie

CO-CHEC 03 - Chromothripsie et péri-conceptologie

Author links open overlay panel FranckPellestor - https://doi.org/10.1016/j.morpho.2016.07.004Get rights and content

Le domaine de la cytogénétique tumorale et constitutionnelle a été récemment bouleversé par la mise en évidence d’un nouveau type de réarrangements complexes et massifs du génome, baptisé « chromothripsis » (de chromos pour chromosome et du grec thripsis pour briser en éclats), dans lequel de multiples réarrangements (jusqu’à plusieurs centaines) se produisent au cours d’un seul événement cellulaire pour aboutir à la formation d’un ou de plusieurs chromosomes fortement remaniés, à l’image d’un patchwork.

Plusieurs caractéristiques communes confèrent une signature particulière au phénomène de chromothripsis, permettant de le distinguer des réarrangements chromosomiques complexes « classiques ». Ainsi, une définition préliminaire du chromothripsis a été proposée, à savoir : un remaniement, pour lequel un minimum de 10 segments d’un seul chromosome est impliqué dans le remaniement, avec pas plus de trois niveaux différents d’anomalies du nombre de copies.

L’existence d’un tel phénomène cataclysmique au sein d’une cellule suscite de nombreuses interrogations quant à sa formation et à son impact sur le fonctionnement cellulaire et la pathologie.

Il s’avère que la plupart des chromothripsis congénitaux ont pour origine la lignée germinale ou les premières divisions embryonnaires. Toute une série d’événements au cours de cette période péri-conceptionnelle peuvent en effet intervenir dans la mise en place du chromothripsis.

Dans le sexe masculin, le phénomène de chromothripsis peut être envisagé au cours des divisions pré-méiotiques ou durant la prophase de la première division méiotique, mais aussi lors de la phase de différenciation des spermatozoïdes. La survenue d’un chromothripsis au cours de l’ovogenèse doit aussi être considérée du fait de la durée particulière de la méiose féminine et des risques accrus d’exposition des chromosomes aux agents endogènes et exogènes de cassures de l’ADN. Enfin, le chromothripsis peut voir le jour au cours des premières divisions embryonnaires qui semblent se caractériser par une instabilité chromosomique accrue, un contrôle du cycle cellulaire très permissif et de fréquentes anomalies de la ségrégation des chromosomes et du clivage des blastomères.

Dans certains cas, la réorganisation complexe des chromosomes qui s’opère, pourrait permettre à la cellule de conserver un statut équilibré à son génome. Le recours à des modes simples de réarrangement comme le NHEJ permet de résoudre rapidement la pulvérisation chromosomique au prix de la génération de remaniements ultra-complexes, mais qui peuvent parfois s’avérer stables et compatibles avec la vie.

La découverte du phénomène de chromothripsis témoigne de la complexité insoupçonnée des phénomènes de restructuration chromosomique et démontrent avec force que « la mécanique chromosomique » ne nous a pas encore livré tous ses secrets. Le phénomène de chromothripsis fournit de nouvelles pistes pour l’étude de pathologies congénitales complexes pour lesquelles l’étiologie restait encore inconnue et les mécanismes de formation mal compris. En dehors du contexte physiopathologique, il relance aussi la discussion sur le rôle des remaniements chromosomiques dans les processus de spéciation au cours de l’évolution et sur le modèle des équilibres ponctués.

View full text - Copyright © 2016 Published by Elsevier Masson SAS

Part of special issue : 98e Congrès Association morphologistes et 21es Journées CHEC

Citing articles (0)

plumX logo

About ScienceDirect Remote access Shopping cart Advertise Contact and support Terms and conditions Privacy policy

We use cookies to help provide and enhance our service and tailor content and ads. By continuing you agree to the use of cookies. Copyright © 2021 Elsevier B.V. or its licensors or contributors. ScienceDirect ® is a registered trademark of Elsevier B.V. ScienceDirect ® is a registered trademark of Elsevier B.V. View full text - Copyright © 2016 Published by Elsevier Masson SAS – Source : https://www.sciencedirect.com/science/article/abs/pii/S1286011516300339

News-Medical

Avertissement : Cette page est une traduction automatique de cette page à l’origine en anglais. Veuillez noter, puisque les traductions sont générées par des machines, toutes les traductions ne seront forcément pas parfaites. Ce site Web et ses pages Web sont destinés à être lus en anglais. Toute traduction de ce site et de ses pages Web peut être imprécise et inexacte, en tout ou en partie. Cette traduction est fournie à titre pratique.

Les chercheurs découvrent le nouveau phénomène mutationnel de chromothripsis dans les cas de cancer - Download PDF Copy - Reviewed by James Ives, M.Psych. (Editor) Feb 6 2020

Les chercheurs à la Faculté de Médecine de Harvard et à l’EMBL-EBI ont effectué la plus grande analyse en travers des types de cancer du chromothripsis mutationnel neuf découvert de phénomène. Cette étude est la plus grande de son genre jusqu’à présent, contenant l’entier-génome ordonnançant (WGS) des caractéristiques de plus de 2600 tumeurs enjambant 38 types de cancer différents.

Chromothripsis

Chromothripsis, ou « chromosome se brisant », est un procédé mutationnel dans lequel les grandes extensions d’un chromosome subissent les réarrangements massifs dans un événement catastrophique unique. L’éclat de régions chromosomiques dans de plus petites pièces, permutent, et rejoignent, menant à une configuration neuve de génome.

En comprenant entièrement comment cette altération pilote l’évolution de génome de cancer, et quels mécanismes moléculaires sont impliqués dans leur rétablissement, soyez des étapes importantes vers l’évolution de compréhension de génome de cancer.

Cette recherche était publiée en génétique de nature en tant qu’élément du Carter-Cancer que l’analyse des génomes entiers (PCAWG) projettent, un effort global comportant la collaboration internationale de plus de 1300 scientifiques. Dans cette étude, les chercheurs ont prouvé que les événements de chromothripsis sont beaucoup plus courants en travers de beaucoup de types de cancer qu’ont précédemment pensé. Ils pourraient également directement lier le chromothripsis aux cachets courants du génome de cancer, y compris l’amplification d’oncogene (une augmentation dans le nombre de copies d’un gène qui peut entraîner le cancer), et la perte de suppresseurs de tumeur (les gènes qui règlent la croissance des cellules et la division).

Prévalence de Chromothripsis dans le cancer

Nous avons intégré des caractéristiques de GT de plus de 2600 tumeurs enjambant plus de 30 types de cancer. De ceci nous avons découvert que les événements de chromothripsis et d’autres types de réarrangements complexes de génome sont dominants en travers des cancers humains, avec des fréquences plus grandes que 50% de tumeurs dans quelques types de cancer. »

Isidro Cortés-Ciriano, chef de groupe à EMBL-EBI et un ancien chercheur post-doctoral à la Faculté de Médecine de Harvard

Utilisant des ensembles de données de GT a donné aux chercheurs un avis amélioré des événements de chromothripsis dans le génome de cancer. Études précédentes regardant le rôle du chromothripsis dans des technologies choix choix à basse résolution employées souvent de cancer et de maladies congénitales. Ici les chercheurs pouvaient prouver que les événements de chromothripsis sont beaucoup plus répandus dans le cancer que précédemment prévu. Ils ont également caractérisé les configurations de l’altération massive de génome en travers des types de cancer, et ont étudié les mécanismes de réparation de l’ADN impliqués dans leur rétablissement.

« Cette étude est encore une autre démonstration du pouvoir du l’entier-génome de grande puissance ordonnançant, » dit le stationnement de Peter, professeur de l’informatique biomédicale à la Faculté de Médecine de Harvard et à l’auteur supérieur du papier. « Il nous a permis de sonder la complexité ahurissante du génome-éclatement en génomes de cancer et de caractériser des traits communs en travers des centaines de cas. »

Chromothripsis et pronostic de cancer

« Les découvertes effectuées dans ce projet nous permettent de comprendre mieux comment le cancer surgit et évolue, ainsi que les configurations de l’altération dans l’ADN des tumeurs humaines, » indique Cortés-Ciriano. « Une partie de cette altération a des implications cliniques intenses et pourrait ouvrir les avenues neuves pour le développement thérapeutique au cours des années à venir. »

Les chercheurs expliquent que le chromothripsis forme le génome de tumeur, menant à la perte de gènes suppresseur de tumeur et à l’amplification des oncogenes pour piloter l’étape progressive de cancer. Chromothripsis a été associé au pronostic faible pour des malades du cancer, mais continuant nous étudie comme cette aide pour comprendre le choc du chromothripsis et de toute autre altération de grande puissance de génome, et comment ils peuvent être employés pour le diagnostic de cancer à l’avenir.

Le projet de Carter - Cancer

L’analyse de Carter-Cancer du projet entier de génomes est une collaboration faisant participer plus de 1300 scientifiques et cliniciens de 37 pays. Il analyse impliquée de plus de 2600 génomes de 38 types différents de tumeur, produisant une ressource énorme en génomes primaires de cancer. C’était le point de départ pour que 16 groupes de travail étudient des aspects multiples de développement du cancer, de causalité, d’étape progressive, et de catégorie. Source : European Molecular Biology Laboratory

Référence de la revue : Cortés-Ciriano, I., et al. (2020) Comprehensive analysis of chromothripsis in 2,658 human cancers using whole-genome sequencing. Nature Genetics. doi.org/10.1038/s41588-019-0576-7. Be the first to rate this article Download PDF Copy

Autres lectures :

Specific wavelength of UV light is safe and effective way to kill SARS-CoV-2 virus

Machine learning and high-powered microscopes provide detailed snapshots of cells’ inner machinery

CAR-T cells require an abundance of antigens to efficiently kill solid tumors

Eating whole grain rye products results in more weight loss than refined wheat diet

Researchers identify a stem cell population with enhanced fracture healing and differentiation abilities

New nutrient profiling system assesses the healthfulness of foods

News-Medical

News-Medical.Net provides this medical information service in accordance with these terms and conditions. Please note that medical information found on this website is designed to support, not to replace the relationship between patient and physician/doctor and the medical advice they may provide. This site complies with the HONcode standard for trustworthy health information : verify here.

AZoNetwork

News-Medical.net - An AZoNetwork Site - Owned and operated by AZoNetwork, © 2000-2021 - https://www.news-medical.net/news/20200206/1091/French.aspx

Image : Kumamon Y. Watson via Wiki Commons. Reproduced under the Creative Commons Attribution-Share Alike 3.0 Unported license.
How Donations Will Help Us - Contact Us About Facebook Twitter RSS

Retour au début du dossier

Sur ce sujet, voir aussi cet annonce d’Inf’OGM :


OGM - Crispr/Cas peut « éclater » les génomes

version PDF - Date de rédaction / mise à jour : 28 octobre 2021 – Document ‘infogm.org’

En juillet 2021, le journal scientifique Nature Biotechnology rapporte qu’une des utilisations de Crispr/Cas peut induire des effets « extrêmement dommageables » dans les génomes. Connu sous le nom de chromothripsie, cet effet a été décrit récemment tant pour des organismes animaux que végétaux. En juillet 2021 également, le cours en bourse d’entreprises utilisant Crispr chutait. Illustration > Alainalele

Mi-juillet 2021, un article d’actualité et de synthèse paru dans dans le journal Nature Biotechnology [1] décrivait un effet négatif de l’utilisation de Crispr/Cas. Il ne s’agit pas cette fois de mutations hors du site de modification génétique ciblé, ni de persistance de séquence d’ADN dans un génome mais d’une « forme extrêmement dommageable de réarrangement génomique » selon le journaliste Cormac Sheridan. Cet effet, nommé chromothripsie, a été décrit à plusieurs reprises dans des articles scientifiques.

Crispr/Cas, générateur de chromothripsie

Le complexe protéique Crispr/Cas est utilisé pour induire des coupures dans une molécule d’ADN. Ces coupures peuvent concerner un seul des deux brins de l’ADN ou les deux brins. On parle alors de coupure double-brin. Dans ce dernier cas, une telle coupure peut induire une chromothripsie, nom donné à un « éclatement de chromosomes individuels et [...] reconstitution ultérieure des morceaux dans un ordre aléatoire ». L’article publié par Nature Biotechnology précise logiquement que la plupart des cellules qui subissent un tel effet ne sont pas viables. Mais certaines peuvent l’être ! Dans ce cas, des protéines oncogéniques, c’est-à-dire capable de provoquer des cancers, peuvent être exprimées. Des séquences génétiques peuvent de leur côté voir leur expression dérégulée, ce qui peut « poser des problèmes ». Dans le cas de l’utilisation de Crispr/Cas en thérapie génique, « les implications cliniques, s’il y en a, restent méconnues » mais « aucune des entreprises leader dans le développement clinique de thérapie avec Crispr/Cas ne semblent avoir pris en compte ce problème » indique Cormac Sheridan.

Cet effet n’est pas le premier observé rappelle le journaliste. Crispr/Cas peut aussi induire de larges délétions de séquences génétiques par exemple, ou avoir une action sur l’expression de la protéine P53 impliquée dans la suppression de tumeurs. Un état des lieux qui interpelle Ben Kleinstiver de l’école médicale de Harvard, interrogé par le journaliste. Selon lui, si les coupures double-brin ont lieu naturellement, « la différence est qu’ici, nous provoquons intentionnellement des coupures double-brin dans les cellules […] nous le faisons activement avec les technologies d’édition du génome, je pense donc qu’il incombe à la communauté scientifique d’étudier et en comprendre les effets secondaires génotoxiques ».

Si l’article publié dans Nature Biotechnology rend compte d’observations sur cellules animales, le même phénomène a déjà été décrit chez les végétaux. Dans un chapitre de synthèse récemment publié [2], Yves Bertheau explique, référence scientifique à l’appui, qu’un effet de chromothripsie peut être dû à des étapes techniques de préparation de cellules végétales en vue d’une modification génétique ou de régénération de plantes après l’étape de modification.

Quelle prise en compte de cet effet négatif ?

Fyodor Urnov, de l’université de Berkeley, un autre chercheur interviewé, estime de son côté que « notre défi est de ne pas succomber à la paralysie épistémique face à ces débuts d’inquiétudes […] Vous pouvez publier mille papiers dans Nature à propos d’inquiétudes précliniques, aucun ne prédira les réels soucis sanitaires qui apparaîtront ». Une approche pour le moins étonnante si elle devait aboutir à convaincre des législateurs à ne plus conduire d’analyses de risques avant la commercialisation d’un produit obtenu par Crispr/Cas.

Cette prise de distance face à un potentiel risque se retrouve également du côté des entreprises interrogées par Cormac Sheridan. Julie Ferguson, d’Intellia, a ainsi affirmé que l’entreprise utilise « diverses évaluations moléculaires sophistiquées mises en place pour détecter les variants structurels chromosomiques » et précise ne pas avoir, à ce jour, observé d’effets liés aux modifications génétiques induites. Cristi Barnett, d’Editas Medecine, affirme également ne pas considérer que ce problème « soit spécifiquement problématique dans la perspetive de produire des médicaments basés sur Crispr ».

Tout le monde ne partageait pourtant pas cet optimisme d’Intellia ou Editas Medecine. Le média en ligne britannique GMWatch note [3] que, selon le site Seeking Alpha, la valeur boursière d’entreprises utilisant Crispr ont chuté en juillet 2021, période de publication de l’article de Nature Biotechnology. GMWatch fait le lien entre la publication de l’article de Cormac Sheridan et les variations des cours en bourse, exposant que « l’impact à long terme de l’édition de gènes sur la santé pourrait ne pas être connu avant 2040 environ […] Compte tenu des perspectives incertaines, les investisseurs seraient bien avisés de réévaluer leurs positions dans les entreprises qui emploient la cassure du double brin d’ADN pour modifier le génome ».

Inf’OGM - Veille citoyenne sur les OGM et les semences

Qui sommes-nous ? Actions Mission et valeurs Qui nous finance ?Equipe et Conseil d’Administration Rapports d’activités et financiers Espace presse - Contact Plan du site Boutique Mentions légales

File:INFOGM logo sans fond.png - Wikimedia Commons

Tous nos articles sont sous licence Creative Commons – Source : https://www.infogm.org/7282-ogm-crispr-cas-peut-eclater-les-genomes

Retour au début du dossier


Traductions, [compléments] et intégration de liens hypertextes par Jacques HALLARD, Ingénieur CNAM, consultant indépendant – 29/10/2021

Site ISIAS = Introduire les Sciences et les Intégrer dans des Alternatives Sociétales

http://www.isias.lautre.net/

Adresse : 585 Chemin du Malpas 13940 Mollégès France

Courriel : jacques.hallard921@orange.fr

Fichier : ISIAS Génétique CRISPR Cancer Mauvaise nouvelle avec la chromothripsie.5

Mis en ligne par le co-rédacteur Pascal Paquin du site inter-associatif, coopératif, gratuit, sans publicité, indépendant de tout parti, géré par Yonne Lautre : https://yonnelautre.fr - Pour s’inscrire à nos lettres d’info > https://yonnelautre.fr/spip.php?breve103

http://yonnelautre.fr/local/cache-vignettes/L160xH109/arton1769-a3646.jpg?1510324931

— -